Home > Module development > 8.Maintenance

Maintenance

 

Basically, you can add/delete modules in the 'Module Library' window. If you downloaded script files and want to add them to the software, just copy script files to the sub folder, "/Script", where you installed Visual Gene Developer. And then re-scan script files in the 'Module Library' window. Since Visual Gene Developer recognizes each module by the Module Identification Key (Module Hash Code), duplicate script files or modules doesn't cause error.

If you understand script file's content and its rule, you can directly edit script files to cut and paste modules.

 


o How to add script files

 

1. Firstly, copy script files (file extension: vgs) to '.../Script' folder.

2. Click on the 'Reload' button

 

o How to delete modules

In the above figure,

3. Choose one of modules

4. Click on the 'Delete Module' button

 

 


o Edit script files

1. Open any script file using Windows NotePad.

2. Cut, delete, copy, or paste text to remove or add modules

 

For example, the following script file includes two modules (blue part and red part) and each module starts with "<//NEW COMPONENT//>" and ends with "<//END OF COMPONENT//>" . If you delete blue text, the module (name: Sample Toolbox) will be disappear from the 'Module Editor' and 'Toolbox' windows.

 

<//Visual Gene Developer Script Language File//>

<//FILE INFO//>
Program version=1.0
<//END OF FILE INFO//>



<//MODULE COLLECTION//>

<//NEW COMPONENT//>
ModuleID=Sample Toolbox
ModuleID_HashCode=2020d651-d94ba8cc-12b331bd-e118d02c-j56z90y2EI
AutoRegister=True
Description=<//

//>
Category=Sub
Language=VBScript
Editable=True
Author=Visual Gene Developer
Property Bag_Param ID=Default Parameter Bag
Property Bag_Param ID_HashCode=b119951b-6c93e0d-1152e84e-4525f18e-cGm5b1vtOa
Property Bag_Prc ID=Default Process Bag
Property Bag_Prc ID_HashCode=3bedfeba-71af71ba-e7c831bd-b26591d7-5eP9qELJ1P
Full Code=<//
Function Main()

Msgbox "You clicked my toolbox1",,"Message"

End Function
//>
<//END OF COMPONENT//>




<//NEW COMPONENT//>
ModuleID=Sample mRNApredict
ModuleID_HashCode=590fe647-85e64b81-12b331bd-4ae1d1a0-FXWcOQ4lXC
AutoRegister=True
Description=<//

//>
Category=Function
Language=VBScript
Editable=True
Author=Visual Gene Developer
Property Bag_Param ID=Default Parameter Bag
Property Bag_Param ID_HashCode=b119951b-6c93e0d-1152e84e-4525f18e-cGm5b1vtOa
Property Bag_Prc ID=Default Process Bag
Property Bag_Prc ID_HashCode=3bedfeba-71af71ba-e7c831bd-b26591d7-5eP9qELJ1P
Full Code=<//
Function Main()
Call mRNApredict.Calculate("GCGGGCGGCGGCTATTGGCACACGATTGGCACACGGCGGCGACTACCGCAGCA",True)
Main=mRNApredict.GibbsFreeEnergy
End Function
//>
<//END OF COMPONENT//>



<//END OF COLLECTION//>