Home > Module development > 4.Module category > mRNA structure

mRNA structure

 

This category is not much different from 'Sequence optimization'. Please check 'Sequence optimization' section.

To optimize mRNA structure, you may have to use additional classes such as 'GeneService', 'mRNApredict' and 'mRNAanalyzer'.

 

o Simple example to use 'mRNApredict' class

 

1. Open the 'mRNApredict Copy' module in the 'Module Library' window

2. Review the source code

      The module calculates mRNA secondary structure, draws a figure, and then exports data to clipboard

3. Click on the 'Test run' button

4. You can see mRNA secondary structure.

 

5. Open Excel, or NotePad.     Paste clipboard.   You can see the new table!

 

 

Here is the source code (VBScript version)

Function Main()
  SourceGene="GCGGGCGGCGGCTATTGGCACACGAGCGGCCGGGAGATCCTGGACGCG"
  Call mRNApredict.Calculate(SourceGene,False)              '<--- Calculate mRNA structure
  Call mRNApredict.ShowStructure()                                 '<--- Show structure image
  GeneLength=mRNApredict.SequenceLength                    '<--- Get sequence size

 


  Temp="Basepair" & Chr(9) & "Energy" & Chr(9) & "Probability" & Chr(13) & Chr(10)

  For q=1 to GeneLength
     Temp=Temp+mRNApredict.BasePair(q) & Chr(9)                                       '<--- Read basepair string
     Temp=Temp+CStr(mRNApredict.Energy(q)) & Chr(9)                                '<--- Read energy
     Temp=Temp+CStr(mRNApredict.Probability(q)) & Chr(13) & Chr(10)       '<--- Read probability

  Next

  AppService.Clipboard_Copy(Temp)                                 '<--- Export data to clipboard

End Function

 

Chr(13) & Chr(1): carriage return,  Chr(9): tab key