mRNApredict
This class is used to predict mRNA secondary structure.
o Summary
o Prediction
|
Module |
Description |
|
Function Calculate (SourceStr As String, IsFastCalculation As Boolean) As String |
Calculate mRNA structure It return "" if no error occurs It is the first function to predict mRNA structure |
o Visualization
|
Module |
Description |
|
Sub ShowStructure () |
Show mRNA structure image to 'mRNA structure viewer' window |
o Hairpin structure
|
Module |
Description |
|
Function Generate_Hairpin (Target_SequenceLength_Min As Integer, Target_SequenceLength_Max As Integer, UnPaired_SequenceLength As Integer, Target_Energy_Min As Single, Target_Energy_Max As Single, Max_Trials As Integer) As String |
Generate mRNA hairpin sequence that has specific Gibbs free energy and size. It return null string ("") if failed
UnPaired_SequenceLength: number of basepair in the center Target_Energy_Min: optional parameter, default value is -500 Target_Energy_Max: optional parameter, default value is 500 Max_Trials: optional parameter, it specifies maximum number of trials to generate hairpin structure, default value is 30
|
o Information
|
Module |
Description |
|
Sub ReadStructure () |
Read mRNA structure to access basepair information It is the first function to call to retrieve information (Alternative is ShowStructure) |
|
Property BasePair (Position As Integer) As String |
Get basepair of current sequence at 'Position' |
|
Function Calculate (SourceStr As String, IsFastCalculation As Boolean) As String |
Calculate mRNA structure Return "" if no error occurs |
|
Property Coordinate_X (Position As Integer) As Single |
Get x coordinate of target basepair ('Position') from predicted mRNA structure |
|
Property Coordinate_Y (Position As Integer) As Single |
Get y coordinate of target basepair ('Position') from predicted mRNA structure |
|
Property DotStructure () As String |
Get dot expression of predicted mRNA secondary structure Calling ShowStructure or ReadStructure is not required |
|
Property Energy (Position As Integer) As Single |
Get binding energy of target basepair ('Position') of predicted mRNA secondary structure |
|
Function Get_AvgEnergy (Start_Position As Integer, End_Position As Integer) As Single |
Get average Gibbs free energy. Start_Position and End_Position are optional Returns 1 if error occurs |
|
Function Get_SumEnergy (Start_Position As Integer, End_Position As Integer) As Single |
Get total Gibbs free energy. Start_Position and End_Position are optional Returns 1 if error occurs |
|
Function Get_AvgProbability (Start_Position As Integer, End_Position As Integer) As Single |
Get average probability. Start_Position and End_Position are optional Returns -1 if error occurs |
|
Function Get_SumProbability (Start_Position As Integer, End_Position As Integer) As Single |
Get sum of probability. Start_Position and End_Position are optional Returns -1 if error occurs |
|
Property GibbsFreeEnergy () As Single |
Get overall Gibbs free energy of predicted mRNA secondary structure Calling ShowStructure or ReadStructure is not required |
|
Property Probability (Position As Integer) As Single |
Get probability of target basepair ('Position') of predicted mRNA secondary structure |
|
Property SequenceLength () As Integer |
Get length of source DNA sequence Calling ShowStructure or ReadStructure is not required |
|
Property OrgDNASequence (SourceSeq As String) As String |
Set source DNA sequence Calling ShowStructure or ReadStructure is not required |
o Example 1
The following VBscript code calculates mRNA secondary structure and then plot it.
|
Function Main() Call mRNApredict.Calculate("GCGGGCGGCGGCTATTGGCACACGAGCGCA",False) Call mRNApredict.ShowStructure End Function |
o Example 2
Calculate mRNA secondary structure and then export to clipboard
|
Function Main() SourceGene="GCGGGCGGCGGCTATTGGCACACGAGCGGCCGGGAGATCCTGGACGCG" Call mRNApredict.Calculate(SourceGene,False) Call mRNApredict.ShowStructure() GeneLength=mRNApredict.SequenceLength
Temp="Basepair" & Chr(9) & "Energy" & Chr(9) & "Probability" & Chr(13) & Chr(10) For q=1 to GeneLength Temp=Temp+mRNApredict.BasePair(q) & Chr(9) Temp=Temp+CStr(mRNApredict.Energy(q)) & Chr(9) Temp=Temp+CStr(mRNApredict.Probability(q)) & Chr(13) & Chr(10) Next
AppService.Clipboard_Copy(Temp) End Function |
o Example 3
Draw mRNA Gibbs free energy profile along source sequence
|
Function Main() '-------- Setting --------------------------------------------------------------------------------------------------------------------- Window_Size=30 'Length of partial test sequence Step_Size=9 'Interval between partial test sequences through entire sequence '------------------------------------------------------------------------------------------------------------------------------------------
SourceSeq=AppService.Workspace_Value If SourceSeq="" then Exit Function End If SourceSeq_Length=Len(SourceSeq) Start_Position=1 End_Position=SourceSeq_Length
Buf_Str=""
'**** Graphics ********************** CustomUI.Define_Canvas 500,200 CustomUI.Form_BringToFront CustomUI.Clear_Canvas CustomUI.Form_Caption="mRNA binding energy profile" CustomUI.DrawLine 30,95,490,95,"LightGray" CustomUI.DrawLine 30,10,30,180,"Black" CustomUI.DrawLine 30,180,490,180,"Black" CustomUI.DrawString 330,160,"G: Gibbs energy (kcal/mol/nt)","Blue" CustomUI.DrawString 15,85,"G","Blue" CustomUI.DrawString 250,180,"Location","Red" CustomUI.DrawString 15,10,"0","Blue" CustomUI.DrawString 1,170,"-0.5","Blue" CustomUI.Set_ForeColor_byName "Black"
'*** Calculate mRNA Gibbs free energy ************************************************ For Current_Position=Start_Position to End_Position - Window_Size step Step_Size
AppService.InstantMsg "Calculating mRNA structure at " + CStr(Current_Position)
TestSeq=Mid(SourceSeq,Current_Position,Window_Size) TestSeq_Length=Len(TestSeq) Call mRNApredict.Calculate(TestSeq,True)
GibbsEnergy=mRNApredict.GibbsFreeEnergy()
X2=(Current_Position-Start_Position )/SourceSeq_Length*480+30 Y2=(-GibbsEnergy/TestSeq_Length)*170/0.5+10 If Current_Position>Start_Position Then CustomUI.DrawLine X1,Y1,X2,Y2 CustomUI.DrawRectangle X2-1,Y2-1,2,2 CustomUI.Update_Canvas End If X1=X2 Y1=Y2
Buf_Str=Buf_Str + CStr(Current_Position) + Chr(9) + CStr(GibbsEnergy/TestSeq_Length) + Chr(13) + Chr(10)
Next
CustomUI.RawData=Buf_Str CustomUI.Make_Clone
End Function |
