Home > Features > 11.Data conversion

Data conversion

 

Since Visual Gene Developer has easy copy & paste functions in many places, users can easily exchange data between the software and other commercial software such as NotePad, Excel, Word, SigmaPlot, Origin and etc. For example, a user may build optimal codon usage table using Excel and then copy the table to Visual Gene Developer to make 'Codon usage and w-table'.

Moreover, our data files (Script, PropertyBag, codon usage and w-table, gene construct file, neural network files) have a standard text format that can be easily editable using other editing software. Therefore, expert users or programmers can make their own modules to process (import/export) our Visual Gene Developer's data files (Check)

Regarding compatible data format, Visual Gene Developer can read DNA sequences from FASTA format file or extract field codes from GenBank format file (Check)

 


o Copy & Paste function

 

o Example 1: Gene construct or Codon Usage Calculation

1. Click on the 'Including full analysis result' menu to export entire gene construct table to clipboard. Paste it to Excel.

2. Click on the 'Copy' button. And then paste it to Excel.

 

3. You can see the pasted gene construct table in the Excel document.

4. You can see the pasted codon usage table in the Excel document.

 

 

 

o Example 2: Paste codon usage table

1. Copy the region

 

2. Click on the 'Format: Triple, Fraction' button

3. New data was pasted from clipboard as shown in the red rectangular region.

 

 

 


o Import data from FASTA or GenBank file

 

- Import DNA sequences from FASTA file

 

 

- Extract field information from GenBank file

 

 

- Directly import Gene List from Clipboard

 


o Data file format

You can open data files using Windows NotePad.

 

 

o Project file (file extension: vgd)

Sample file. Project file has the most complicated data format. But easy to read.

<//Visual Gene Developer Project File//>

<//FILE INFO//>
Program version=1.0
Title=Untitled
Gene construct name=
Author=
Description=<//

//>
Date and Progress=<//

//>
Global W-Table file name=Nicotiana benthamiana.vgw
<//END OF FILE INFO//>



<//W-TABLE COLLECTION//>
<//NEW COMPONENT//>
ID#=1
Name=Nicotiana benthamiana
File name=Nicotiana benthamiana.vgw
<//END OF COMPONENT//>

<//END OF COLLECTION//>



<//GENE COMPONENT COLLECTION//>
<//NEW COMPONENT//>
ID#=1
Title=Start codon
ModuleID=Common coding region
ModuleID_HashCode=51d10b38-3c2c90f-db049523-534f8717-5Y5ibo6jcD
Description=<//
ATG start codon
//>
Parameter=<//
Original AA=M
Original DNA=ATG
Modified DNA=ATG
//>
<//END OF COMPONENT//>

<//NEW COMPONENT//>
ID#=2
Title=Gene
ModuleID=Common coding region
ModuleID_HashCode=51d10b38-3c2c90f-db049523-534f8717-5Y5ibo6jcD
Description=<//
Target gene
//>
Parameter=<//
Original AA=AAAAAAAAAA
Original DNA=GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Modified DNA=GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
//>
<//END OF COMPONENT//>

<//NEW COMPONENT//>
ID#=3
Title=Stop codon
ModuleID=Common coding region
ModuleID_HashCode=51d10b38-3c2c90f-db049523-534f8717-5Y5ibo6jcD
Description=<//
Stop codon, TGA
//>
Parameter=<//
Original AA=*
Original DNA=TGA
Modified DNA=TGA
//>
<//END OF COMPONENT//>

<//END OF COLLECTION//>



<//SEQUENCE OPTIMIZATION COLLECTION//>
<//NEW COMPONENT//>
ModuleID=Monte-Carlo Codon Optimization
ModuleID_HashCode=c64b0b39-fa514a4f-db049523-ba5f1d04-1rVfJ2277b
Title=Codon optimization
Description=<//

//>
Target Gene Component ID#=2
Target W-table ID#=1
Activated=True
Parameter=<//
Target Gene Component ID=Gene
Target W-table ID=Nicotiana benthamiana.vgw
Number of mutation=30
Exclude rare codons=False
Rare codon threshold fraction=0.1
Title caption 1=Number of mutation
Title caption 2=
//>
<//END OF COMPONENT//>

<//END OF COLLECTION//>



<//mRNA STRUCTURE OPTIMIZATION COLLECTION//>
<//NEW COMPONENT//>
ModuleID=Hairpin structure
ModuleID_HashCode=
Title=Test version of mRNA optimization
Description=<//

//>
Target Gene Component ID#=2
Target W-table ID#=0
Activated=True
Parameter=<//
Target Gene Component ID=Gene
Test parameter=1
Test threshold=2
Title caption 1=
Title caption 2=
//>
<//END OF COMPONENT//>

<//END OF COLLECTION//>



<//GENE MANIPULATION COLLECTION//>
<//NEW COMPONENT//>
ModuleID=Define sequence
ModuleID_HashCode=
Title=Test version of gene manipulation
Description=<//

//>
Target Gene Component ID#=2
Target W-table ID#=0
Activated=True
Parameter=<//
Target Gene Component ID=Gene
Start position=10
End position=15
Sequence=CACAGT
Title caption 1=
Title caption 2=
//>
<//END OF COMPONENT//>

<//END OF COLLECTION//>



<//GENE OPTIMIZATION CONDITION COLLECTION//>
<//NEW COMPONENT//>
ModuleID=Exclude restriction enzyme site
ModuleID_HashCode=51b00b37-9725fcde-db049523-1b537bea-NMpS9yGAe7
Title=Exclude restriction enzyme site
Description=<//

//>
Target Gene Component ID#=2
Target W-table ID#=0
Activated=True
Parameter=<//
Target Gene Component ID=Gene
Restriction enzyme=XhoI
Check borders=True
Title caption 1=Restriction enzyme
Title caption 2=
//>
<//END OF COMPONENT//>

<//NEW COMPONENT//>
ModuleID=Exclude sequence
ModuleID_HashCode=c64b0b3a-75106c86-db049523-8d52620f-AmPwGineSx
Title=Exclude sequence
Description=<//

//>
Target Gene Component ID#=2
Target W-table ID#=0
Activated=True
Parameter=<//
Target Gene Component ID=Gene
Sequence=TGATGACTGT
Check borders=True
Title caption 1=Sequence
Title caption 2=
//>
<//END OF COMPONENT//>

<//NEW COMPONENT//>
ModuleID=Exclude repeated sequence
ModuleID_HashCode=dd150b38-8d671099-db049523-65e2dbf8-9WAYCt4VPi
Title=Exclude repeated sequence
Description=<//

//>
Target Gene Component ID#=2
Target W-table ID#=0
Activated=True
Parameter=<//
Target Gene Component ID=Gene
Min size=10
Max size=10
Smart filter=True
Allowable number=10
Title caption 1=Allowable number
Title caption 2=
//>
<//END OF COMPONENT//>

<//END OF COLLECTION//>



<//GENE VIEW SETTING COLLECTION//>

<//NEW COMPONENT//>
Caption=[Gene] CAI
Target Gene Component ID#=2
Target W-table ID#=1
ModuleID=CAI
ModuleID_HashCode=23fb0b39-72918494-db049523-70a9b6ca-EpRtRNBsX4
Parameter=<//
Target Gene Component ID=Gene
Target W-table ID=Nicotiana benthamiana.vgw
Bulmer's w correction=Include
//>
<//END OF COMPONENT//>

<//NEW COMPONENT//>
Caption=[Gene] Mismatched DNA
Target Gene Component ID#=2
Target W-table ID#=0
ModuleID=Mismatched DNA
ModuleID_HashCode=23fb0b30-794123f-db049523-98faa5c4-SsgU4V49lx
Parameter=<//
Target Gene Component ID=Gene
Unit=Percent
//>
<//END OF COMPONENT//>

<//NEW COMPONENT//>
Caption=[Gene] Overall GC (%)
Target Gene Component ID#=2
Target W-table ID#=0
ModuleID=GC content
ModuleID_HashCode=af600b3c-56450cd4-db049523-17e639b6-7SOgucmuG7
Parameter=<//
Target Gene Component ID=Gene
1st letter=Include
2nd letter=Include
3rd letter=Include
Unit=Percent
//>
<//END OF COMPONENT//>

<//END OF COLLECTION//>
 

 

 

o Script file (file extension: vgs)

Example file

 

<//Visual Gene Developer Script Language File//>
<//FILE INFO//>
Program version=1.0
<//END OF FILE INFO//>



<//MODULE COLLECTION//>

<//NEW COMPONENT//>
ModuleID=Sample JScript Sum
ModuleID_HashCode=fc6fd99d-507df836-2363e148-d3f01aa5-8iyaLdNsur
Description=<//
//>
Category=Function
Language=JScript
Editable=True
Author=
Property Bag_Param ID=Default Parameter Bag
Property Bag_Param ID_HashCode=b119951b-6c93e0d-1152e84e-4525f18e-cGm5b1vtOa
Property Bag_Prc ID=Default Process Bag
Property Bag_Prc ID_HashCode=3bedfeba-71af71ba-e7c831bd-b26591d7-5eP9qELJ1P
Full Code=<//
function Main() {
SumValue=0;
for (q=0;q<10001;q++) {
SumValue+=q }
return SumValue;
}
//>
<//END OF COMPONENT//>



<//NEW COMPONENT//>
ModuleID=Sample mRNApredict
ModuleID_HashCode=590fe647-85e64b81-12b331bd-4ae1d1a0-FXWcOQ4lXC
Description=<//
//>
Category=Function
Language=VBScript
Editable=True
Author=
Property Bag_Param ID=Default Parameter Bag
Property Bag_Param ID_HashCode=b119951b-6c93e0d-1152e84e-4525f18e-cGm5b1vtOa
Property Bag_Prc ID=Default Process Bag
Property Bag_Prc ID_HashCode=3bedfeba-71af71ba-e7c831bd-b26591d7-5eP9qELJ1P
Full Code=<//
Function Main()
Call mRNApredict.Calculate("GCGGGCGGCGGCTATTGGCACACGAGCGGCCGGGAGATCC

ACGCGAACAACGTGCCGGTACGGATCGCCGGCATCAACTGGTTTGGGTTCGAAACC

TGCAATTACGTCGTGCACGGTCTCTGGTCACGCGACTACCGCAGCA",True)
Main=mRNApredict.GibbsFreeEnergy
End Function
//>
<//END OF COMPONENT//>

<//END OF COLLECTION//>

 

Information: sequence should be single string.

 

 

 

o PropertyBag file (file extension: vgp)

Example file

 

<//Visual Gene Developer PropertyBag File//>

<//FILE INFO//>
Program version=1.0
<//END OF FILE INFO//>
 


<//PROPERTYBAG COLLECTION//>

<//NEW PROPERTYBAG//>
ID=Neural Network (Structure)
ID_HashCode=b62cd611-d87e995a-e7c831bd-c4d70658-EVoVnIXanl
Category=Function
Width ratio=0.5
Editable=True
Author=Visual Gene Developer Developer
Description=<//
System PropertyBag
//>


<//NEW PROPERTY//>
Name=Number of input variables
VariableType=Integer
Value=2
CellType=Text
StringCollection=<//
//>
Enable=True
Height (Line)=1
<//END OF PROPERTY//>

<//NEW PROPERTY//>
Name=Number of output variables
VariableType=Integer
Value=1
CellType=Text
StringCollection=<//
//>
Enable=True
Height (Line)=1
<//END OF PROPERTY//>

<//NEW PROPERTY//>

Name=Number of hidden layer
VariableType=String
Value=1
CellType=ComboBox
StringCollection=<//
1
2
3
4
5
//>
Enable=True
Height (Line)=1
<//END OF PROPERTY//>


<//END OF COMPONENT//>

 

<//END OF COLLECTION//>

 

 

 

o Codon usage and w-table file (file extension: vgw)

Example file

<//Visual Gene Developer W-table File//>

Program version=1.0
Organism=Nicotiana benthamiana
Source=Kazusa codon database (www.kazusa.or.jp/codon)
Comment=<//
100 CDS's (43763 codons)
//>
Author=
Date=2009-11-24

Table description=Number,Triplet,Amino acid, Abbrev, Fraction,Frequency, Number of codons, RSCU, RSCUmax, Wi,Relation_Start,Relation_End

<//NEW TABLE//>
1,TAA,Stop,*,0.32,0.7,32,0.96,1.17,0.8205,1,3
2,TGA,Stop,*,0.39,0.9,39,1.17,1.17,1,1,3
3,TAG,Stop,*,0.29,0.7,29,0.87,1.17,0.7436,1,3
4,GCG,Ala,A,0.09,6.5,283,0.36,1.76,0.2045,4,7
5,GCT,Ala,A,0.44,33.2,1452,1.76,1.76,1,4,7
6,GCC,Ala,A,0.17,12.6,550,0.68,1.76,0.3864,4,7
7,GCA,Ala,A,0.31,23.5,1029,1.24,1.76,0.7045,4,7
8,TGC,Cys,C,0.44,7.2,315,0.88,1.12,0.7857,8,9
9,TGT,Cys,C,0.56,9.2,404,1.12,1.12,1,8,9
10,GAC,Asp,D,0.3,16.4,719,0.6,1.4,0.4286,10,11
11,GAT,Asp,D,0.7,38.5,1686,1.4,1.4,1,10,11
12,GAA,Glu,E,0.53,35.2,1541,1.06,1.06,1,12,13
13,GAG,Glu,E,0.47,30.9,1351,0.94,1.06,0.8868,12,13
14,TTC,Phe,F,0.43,17.6,771,0.86,1.14,0.7544,14,15
15,TTT,Phe,F,0.57,23.7,1036,1.14,1.14,1,14,15
16,GGC,Gly,G,0.16,11.4,500,0.64,1.4,0.4571,16,19
17,GGT,Gly,G,0.35,24.3,1065,1.4,1.4,1,16,19
18,GGA,Gly,G,0.32,22.5,986,1.28,1.4,0.9143,16,19
19,GGG,Gly,G,0.16,11.1,485,0.64,1.4,0.4571,16,19
20,CAT,His,H,0.61,12.9,566,1.22,1.22,1,20,21
21,CAC,His,H,0.39,8.2,360,0.78,1.22,0.6393,20,21
22,ATT,Ile,I,0.51,26.7,1170,1.53,1.53,1,22,24
23,ATA,Ile,I,0.23,12.1,530,0.69,1.53,0.451,22,24
24,ATC,Ile,I,0.26,13.9,610,0.78,1.53,0.5098,22,24
25,AAA,Lys,K,0.43,29,1269,0.86,1.14,0.7544,25,26
26,AAG,Lys,K,0.57,38,1662,1.14,1.14,1,25,26
27,CTA,Leu,L,0.1,9.2,404,0.6,1.56,0.3846,27,32
28,CTT,Leu,L,0.26,24.9,1091,1.56,1.56,1,27,32
29,CTG,Leu,L,0.12,11.9,522,0.72,1.56,0.4615,27,32
30,CTC,Leu,L,0.13,12.5,545,0.78,1.56,0.5,27,32
31,TTG,Leu,L,0.25,24.3,1062,1.5,1.56,0.9615,27,32
32,TTA,Leu,L,0.13,12.8,559,0.78,1.56,0.5,27,32
33,ATG,Met,M,1,23.9,1044,1,1,1,33,33
34,AAC,Asn,N,0.37,16.9,741,0.74,1.26,0.5873,34,35
35,AAT,Asn,N,0.63,29.1,1272,1.26,1.26,1,34,35
36,CCC,Pro,P,0.13,6.4,278,0.52,1.56,0.3333,36,39
37,CCG,Pro,P,0.13,6.5,284,0.52,1.56,0.3333,36,39
38,CCT,Pro,P,0.39,18.9,826,1.56,1.56,1,36,39
39,CCA,Pro,P,0.35,16.8,734,1.4,1.56,0.8974,36,39
40,CAG,GIn,Q,0.49,17,745,0.98,1.02,0.9608,40,41
41,CAA,GIn,Q,0.51,18.1,790,1.02,1.02,1,40,41
42,CGA,Arg,R,0.11,5.8,253,0.66,1.8,0.3667,42,47
43,CGC,Arg,R,0.08,4.2,183,0.48,1.8,0.2667,42,47
44,CGG,Arg,R,0.1,5.3,233,0.6,1.8,0.3333,42,47
45,AGA,Arg,R,0.3,15.8,690,1.8,1.8,1,42,47
46,AGG,Arg,R,0.25,13,569,1.5,1.8,0.8333,42,47
47,CGT,Arg,R,0.15,7.7,335,0.9,1.8,0.5,42,47
48,TCG,Ser,S,0.07,5.6,247,0.42,1.68,0.25,48,53
49,TCT,Ser,S,0.28,22.3,974,1.68,1.68,1,48,53
50,TCA,Ser,S,0.21,17.2,752,1.26,1.68,0.75,48,53
51,AGC,Ser,S,0.13,10.7,469,0.78,1.68,0.4643,48,53
52,AGT,Ser,S,0.18,14.7,642,1.08,1.68,0.6429,48,53
53,TCC,Ser,S,0.13,10.4,453,0.78,1.68,0.4643,48,53
54,ACC,Thr,T,0.21,10.1,443,0.84,1.44,0.5833,54,57
55,ACG,Thr,T,0.11,5.4,236,0.44,1.44,0.3056,54,57
56,ACA,Thr,T,0.32,15.2,665,1.28,1.44,0.8889,54,57
57,ACT,Thr,T,0.36,17.4,762,1.44,1.44,1,54,57
58,GTC,Val,V,0.17,10.6,465,0.68,1.68,0.4048,58,61
59,GTT,Val,V,0.42,26.1,1142,1.68,1.68,1,58,61
60,GTG,Val,V,0.25,15.6,684,1,1.68,0.5952,58,61
61,GTA,Val,V,0.16,9.9,435,0.64,1.68,0.381,58,61
62,TGG,Trp,W,1,12.4,542,1,1,1,62,62
63,TAC,Tyr,Y,0.45,12.8,562,0.9,1.1,0.8182,63,64
64,TAT,Tyr,Y,0.55,15.8,690,1.1,1.1,1,63,64
<//END OF TABLE//>
 

 

 

 

o Neural network file (file extension: vgn)

Apparently, Neural network file format is slightly different from those of other data files. However, it is a higher standard INI text format.

[Application]
Name=Visual Gene Developer - Neural Network

[Topology]
Total input= 3
Total output= 2
Total layer= 4
Transfer function=Hyperbolic tangent

[Training information]
learning rate= .01
momentum coefficient= .1

[Total node]
layer=total node
02= 10
03= 10

[Threshold value]
layer-node=threshold value
01-01= 0
01-02= 0
01-03= 0
02-01= .204575534930187
02-02=-1.33314192078855
02-03= .149325527751535
02-04=-.050332663578889
02-05=-.432908037244978
02-06=-.219358295992428
02-07= .0508166033320761
02-08=-.425838981532361
02-09=-.0268054149932054
02-10=-.0582929619036443
03-01= .00221217440662622
03-02= .0763888980924382
03-03= .329742360845628
03-04= .0731216821862698
03-05=-.118725991647911
03-06= .15208737294203
03-07= .467037496211995
03-08= .319988381366443
03-09=-.088927788581074
03-10=-.430560337435663
04-01= 1.18505551330385
04-02= .870058007881169

[Weight factor]
layer-node(layer n-1)-node(layer n)=weight factor
02-01-01=-.142465728139312
02-01-02= 1.23316358833578
02-01-03= .0598620226310375
02-01-04= .341439010315702
02-01-05= .475708539138002
02-01-06= .133343336455446
02-01-07=-.0384704271127384
02-01-08= .37471335723795
02-01-09= .134792684795357
02-01-10= .124129171440245
02-02-01=-.11092222453947
02-02-02= .445044278081299
02-02-03= .245621669722934
02-02-04= .0335901563485933
02-02-05= .406069940028389
02-02-06= .297479444764518
02-02-07= .222729679723579
02-02-08= .362179446122576
02-02-09= .25231337085387
02-02-10=-.00161837522393597
02-03-01= .0265594183918786
02-03-02=-.0225376268456821
02-03-03=-.337704644965481
02-03-04= .0111775868636452
02-03-05=-.260998236150588
02-03-06=-.15821932701303
02-03-07=-.0585435390902084
02-03-08=-.0551834122679033
02-03-09=-.271216283425194
02-03-10= .0268732849716114
03-01-01= .056620132501083
03-01-02=-.0984226688441288
03-01-03=-.160334158616467
03-01-04= .0913909456173134
03-01-05=-.0219165735143777
03-01-06= .137292255428173
03-01-07= .120147331168387
03-01-08= .182522876190597
03-01-09= .0542985749899223
03-01-10=-.237237603230031
03-02-01= .0109658348210399
03-02-02= .28060568262544
03-02-03=-.0861432346562726
03-02-04= .32620938865502
03-02-05=-.182760824743274
03-02-06=-.0750979563654032
03-02-07= .0334574031848833
03-02-08= .0302293553733102
03-02-09=-.155092142715222
03-02-10= 1.44661739066899
03-03-01=-.183497252509049
03-03-02= .264031057524686
03-03-03= .118244584800091
03-03-04= .0990148318962911
03-03-05=-.27332387662842
03-03-06= .211860374956649
03-03-07= .199046711908068
03-03-08= .281241717427215
03-03-09=-.0104994519303229
03-03-10= .0552453175979049
03-04-01=-.157990653365516
03-04-02= .124313542479398
03-04-03=-.0237747809498252
03-04-04=-.0613697650255699
03-04-05= .00306463984261719
03-04-06= .125735389519896
03-04-07= .0288455789375952
03-04-08=-.130795175791403
03-04-09= .0943770759594828
03-04-10= .364782748208814
03-05-01= .14388100119317
03-05-02= .115864915743195
03-05-03= .225822801215344
03-05-04= .379687544725033
03-05-05=-.109734473690662
03-05-06=-.0769483935120361
03-05-07=-.00442234218648285
03-05-08= .15490601617789
03-05-09=-.147832092485993
03-05-10= .688305595653967
03-06-01=-.183687053136459
03-06-02= .212285293559109
03-06-03= .213909817910091
03-06-04= .11916732808471
03-06-05= .0494463260093099
03-06-06= .135006265683664
03-06-07=-.118852900283374
03-06-08= .0320592346131113
03-06-09= .0396805746680734
03-06-10= .256197032349732
03-07-01=-.207501924221779
03-07-02= .0599744303408963
03-07-03=-.106234557751709
03-07-04= .111305877470577
03-07-05=-.0979019777438851
03-07-06= .187843738834532
03-07-07=-.0212511061109013
03-07-08= .0135725554647875
03-07-09= .0583162378519197
03-07-10= .0880173630721683
03-08-01=-.0275064305351923
03-08-02= .0456573352127019
03-08-03= .00699782384519198
03-08-04= .0159077854850617
03-08-05=-.140947775954522
03-08-06=-.178071803742817
03-08-07= .132983176473009
03-08-08=-.130145093316414
03-08-09= .20054588182491
03-08-10= .631264419891009
03-09-01=-.179352256657855
03-09-02= .302253215397899
03-09-03= .0347857375912708
03-09-04= .161986904966158
03-09-05=-.281533769128674
03-09-06= .0202879403061928
03-09-07= .101465593871827
03-09-08= .056298342539851
03-09-09= .144366584581704
03-09-10= .179868083099258
03-10-01=-.18765796264014
03-10-02= .0372451909187969
03-10-03=-.164039303926339
03-10-04= .1861098030696
03-10-05=-.0673352683178034
03-10-06=-.093692229894394
03-10-07=-.0892190502675518
03-10-08=-.134419546914707
03-10-09= .0602303959534809
03-10-10= .0810661142258763
04-01-01=-.136704956726938
04-01-02=-.100831320922393
04-02-01= .326557771373658
04-02-02= .506100327291666
04-03-01= .283723986654401
04-03-02= .186798668278671
04-04-01= .467440470276478
04-04-02= .409993145389273
04-05-01=-.432863784888003
04-05-02=-.208829165860504
04-06-01= .257890094894314
04-06-02=-.0096202947925038
04-07-01= .448196363074475
04-07-02= .285314016453218
04-08-01= .332277500002245
04-08-02= .235746591143904
04-09-01=-.040482495036058
04-09-02= .0244819150232325
04-10-01= 1.03758951778535
04-10-02= .397508434261789